New York City Subways Air Survey; station Chambersenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349510SAMN01086965NSZ2O1P00New York City Subways Air Survey station Chambers655179air metagenomebiosample1086965StationChambersSample_number2dateAugust, 2007New York City Subways Air Survey; station Chambersenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349509SAMN01086964NSZ1O1P00New York City Subways Air Survey station Chambers655179air metagenomebiosample1086964StationChambersSample_number2dateMarch, 2007New York City Subways Air Survey; station Chambersenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349508SAMN01086963NSY2O1P00New York City Subways Air Survey station Chambers655179air metagenomebiosample1086963StationChambersSample_number1dateAugust, 2007New York City Subways Air Survey; station Times Squareenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349507SAMN01086962NSU3O1P00New York City Subways Air Survey station Times Square655179air metagenomebiosample1086962StationTimes SquareSample_number2dateAugust, 2008New York City Subways Air Survey; station Times Squareenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349506SAMN01086961NSU2O1P00New York City Subways Air Survey station Times Square655179air metagenomebiosample1086961StationTimes SquareSample_number2dateAugust, 2007New York City Subways Air Survey; station Times Squareenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349505SAMN01086960NST2O1P00New York City Subways Air Survey station Times Square655179air metagenomebiosample1086960StationTimes SquareSample_number1dateAugust, 2007New York City Subways Air Survey; station Times Squareenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349504SAMN01086959NST1O1P00New York City Subways Air Survey station Times Square655179air metagenomebiosample1086959StationTimes SquareSample_number1dateMarch, 2007New York City Subways Air Survey; station Grand Central 456environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349503SAMN01086958NSQ3O1P00New York City Subways Air Survey station Grand Central 456655179air metagenomebiosample1086958StationGrand Central 456Sample_number2dateAugust, 2008New York City Subways Air Survey; station Grand Central 456environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349502SAMN01086957NSP3O1P00New York City Subways Air Survey station Grand Central 456655179air metagenomebiosample1086957StationGrand Central 456Sample_number1dateAugust, 2008New York City Subways Air Survey; station Grand Central 456environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349501SAMN01086956NSP1O1P00New York City Subways Air Survey station Grand Central 456655179air metagenomebiosample1086956StationGrand Central 456Sample_number1dateMarch, 2007New York City Subways Air Survey; station Grand Central 7environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349500SAMN01086955NSM3O1P00New York City Subways Air Survey station Grand Central 7655179air metagenomebiosample1086955StationGrand Central 7Sample_number2dateAugust, 2008New York City Subways Air Survey; station Grand Central 7environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349499SAMN01086954NSM2O1P00New York City Subways Air Survey station Grand Central 7655179air metagenomebiosample1086954StationGrand Central 7Sample_number2dateAugust, 2007New York City Subways Air Survey; station Grand Central 7environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349498SAMN01086953NSL3O1P00New York City Subways Air Survey station Grand Central 7655179air metagenomebiosample1086953StationGrand Central 7Sample_number1dateAugust, 2008New York City Subways Air Survey; station Grand Central 7environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349497SAMN01086952NSL1O1P00New York City Subways Air Survey station Grand Central 7655179air metagenomebiosample1086952StationGrand Central 7Sample_number1dateMarch, 2007New York City Subways Air Survey; station Grand Central Mezzanineenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349496SAMN01086951NSK3O1P00New York City Subways Air Survey station Grand Central Mezzanine655179air metagenomebiosample1086951StationGrand Central MezzanineSample_number1dateAugust, 2008New York City Subways Air Survey; station Grand Central Mezzanineenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349495SAMN01086950NSK2O1P00New York City Subways Air Survey station Grand Central Mezzanine655179air metagenomebiosample1086950StationGrand Central MezzanineSample_number1dateAugust, 2007New York City Subways Air Survey; station City Hallenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349494SAMN01086949NSH3O1P00New York City Subways Air Survey station City Hall655179air metagenomebiosample1086949StationCity HallSample_number1dateAugust, 2008New York City Subways Air Survey; station City Hallenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349493SAMN01086948NSH1O1P00New York City Subways Air Survey station City Hall655179air metagenomebiosample1086948StationCity HallSample_number1dateMarch, 2007New York City Subways Air Survey; station Union 14environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349492SAMN01086947NSG2O1P00New York City Subways Air Survey station Union 14655179air metagenomebiosample1086947StationUnion 14Sample_number2dateAugust, 2007New York City Subways Air Survey; station Union 14environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349491SAMN01086946NSG1O1P00New York City Subways Air Survey station Union 14655179air metagenomebiosample1086946StationUnion 14Sample_number2dateMarch, 2007New York City Subways Air Survey; station Union 14environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349490SAMN01086945NSF3O1P00New York City Subways Air Survey station Union 14655179air metagenomebiosample1086945StationUnion 14Sample_number1dateAugust, 2008New York City Subways Air Survey; station Union 14environmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349489SAMN01086944NSF2O1P00New York City Subways Air Survey station Union 14655179air metagenomebiosample1086944StationUnion 14Sample_number1dateAugust, 2007New York City Subways Air Survey; station Union Squareenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349488SAMN01086943NSE3O1P00New York City Subways Air Survey station Union Square655179air metagenomebiosample1086943StationUnion SquareSample_number1dateAugust, 2008New York City Subways Air Survey; station Bowling Greenenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349487SAMN01086942NSB3O1P00New York City Subways Air Survey station Bowling Green655179air metagenomebiosample1086942StationBowling GreenSample_number2dateAugust, 2008New York City Subways Air Survey; station Bowling Greenenvironmental air sample poolAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349486SAMN01086941NSB2O1P00New York City Subways Air Survey station Bowling Green655179air metagenomebiosample1086941StationBowling GreenSample_number2dateAugust, 2007New York City Subways Air Survey station Bowling Greenpool of air metagenomic samplesAMPLICONGENOMICPCR00Technical ReadPrimer11Application ReadForward22454 GS FLXNew York City Subway Air Survey for 16S rRNACulture-Independent Analysis of Aerosol Microbiology in a Metropolitan Subway System. Air Samples from New York City Subway Stations and Union Square Park.air metagenomebioproject169671trueSRS349485SAMN01086940NSB1O1P00New York City Subways Air Survey station Bowling Green655179air metagenomebiosample1086940StationBowling GreenSample_number2dateMarch, 2007The microbiome of the upper troposphereGRIP_16SAMPLICONGENOMICPCR00Technical ReadAdapter11Technical ReadBarCode52Application ReadForward12454 GS FLX TitaniumGRIP campaign air samples 16S ampliconSamples from the atmosphere at high altitudes. Air samples from hurricanes, clouds, high altitudes (>10km) and low altitudes (~4km)air metagenomebioproject170715trueSRS351360SAMN01091733FewClouds_20100920Transit flight to St Croix few clouds high altitude(FewClouds_20100920)655179air metagenomeTransit flight to St Croix few clouds high altitudebiosample1091733AGTCGACThe microbiome of the upper troposphereGRIP_16SAMPLICONGENOMICPCR00Technical ReadAdapter11Technical ReadBarCode52Application ReadForward12454 GS FLX TitaniumGRIP campaign air samples 16S ampliconSamples from the atmosphere at high altitudes. Air samples from hurricanes, clouds, high altitudes (>10km) and low altitudes (~4km)air metagenomebioproject170715trueSRS351359SAMN01091732LowAltitude_20100917Low altitde sample over FL(LowAltitude_20100917)655179air metagenomeLow altitde sample over FLbiosample1091732TCTTGGCThe microbiome of the upper troposphereGRIP_16SAMPLICONGENOMICPCR00Technical ReadAdapter11Technical ReadBarCode52Application ReadForward12454 GS FLX TitaniumGRIP campaign air samples 16S ampliconSamples from the atmosphere at high altitudes. Air samples from hurricanes, clouds, high altitudes (>10km) and low altitudes (~4km)air metagenomebioproject170715trueSRS351358SAMN01091731Karl_20100917Hurricane Karl cat 2-3(Karl_20100917)655179air metagenomeHurricane Karl cat 2-3biosample1091731TAATCTCThe microbiome of the upper troposphereGRIP_16SAMPLICONGENOMICPCR00Technical ReadAdapter11Technical ReadBarCode52Application ReadForward12454 GS FLX TitaniumGRIP campaign air samples 16S ampliconSamples from the atmosphere at high altitudes. Air samples from hurricanes, clouds, high altitudes (>10km) and low altitudes (~4km)air metagenomebioproject170715trueSRS351356SAMN01091729Karl_20100916Hurricane Karl cat 1-2(Karl_20100916)655179air metagenomeHurricane Karl cat 1-2biosample1091729TCCGCTCThe microbiome of the upper troposphereGRIP_16SAMPLICONGENOMICPCR00Technical ReadAdapter11Technical ReadBarCode52Application ReadForward12454 GS FLX TitaniumGRIP campaign air samples 16S ampliconSamples from the atmosphere at high altitudes. Air samples from hurricanes, clouds, high altitudes (>10km) and low altitudes (~4km)air metagenomebioproject170715trueSRS351346SAMN01091719Earl_20100830Hurricane Earl cat 2 (Earl_20100830)655179air metagenomeHurricane Earl cat 2biosample1091719TTCGAGCThe microbiome of the upper troposphereGRIP_16SAMPLICONGENOMICPCR00Technical ReadAdapter11Technical ReadBarCode52Application ReadForward12454 GS FLX TitaniumGRIP campaign air samples 16S ampliconSamples from the atmosphere at high altitudes. Air samples from hurricanes, clouds, high altitudes (>10km) and low altitudes (~4km)air metagenomebioproject170715trueSRS351345SAMN01091718Earl_20100829Hurricane Earl cat 1 (Earl_20100829)655179air metagenomeHurricane Earl cat 1biosample1091718AACCAGCThe microbiome of the upper troposphereGRIP_16SAMPLICONGENOMICPCR00Technical ReadAdapter11Technical ReadBarCode52Application ReadForward12454 GS FLX TitaniumGRIP campaign air samples 16S ampliconSamples from the atmosphere at high altitudes. Air samples from hurricanes, clouds, high altitudes (>10km) and low altitudes (~4km)air metagenomebioproject170715trueSRS351344SAMN01091717Clouds_20120817High altitudes clouds Gulf of Mexico (Clouds_20120817)655179air metagenomeHigh altitudes clouds Gulf of Mexicobiosample1091717ACAAGGCThe microbiome of the upper troposphereGRIP_16SAMPLICONGENOMICPCR00Technical ReadAdapter11Technical ReadBarCode52Application ReadForward12454 GS FLX TitaniumGRIP campaign air samples 16S ampliconSamples from the atmosphere at high altitudes. Air samples from hurricanes, clouds, high altitudes (>10km) and low altitudes (~4km)air metagenomebioproject170715trueSRS351343SAMN01091716Transit_20100813Transit flight from CA to FL(Transit_20100813)655179air metagenomeTransit flight from CA to FLbiosample1091716TGACGACThe microbiome of the upper troposphereGRIP_16SAMPLICONGENOMICPCR00Technical ReadAdapter11Technical ReadBarCode52Application ReadForward12454 GS FLX TitaniumGRIP campaign air samples 16S ampliconSamples from the atmosphere at high altitudes. Air samples from hurricanes, clouds, high altitudes (>10km) and low altitudes (~4km)air metagenomebioproject170715trueSRS350370SAMN01090408Test_20100810Test Flight Off coast CA655179air metagenomeTest Flight Off coast CAbiosample1090408CAAGAACSRX220436experiment15run8leaves_RM_epiphyteSRP018030Primer 799F (5'-AACMGGATTAGATACCCKG-3'), which minimizes contamination from plastid DNA (Chelius and Triplett, 2001) and a primer designed for this study, 1193r (5'-ACGTCATCCCCACCTTCC-3'), were used to amplify V5, V6 and V7 of the 16S rRNA gene. The forward primer was fused to the 454 Life Sciences primer B and the reverse primer was fused to the adapter A and a barcode in order to sequence the hypervariable regions V6 and V7. Each 25 µl PCR reaction contained 10 ng (for the endophytic fraction) or 1 ng (for the epiphytic fraction) of DNA, Mg2+ free PCR buffer (TaKaRa), 3mM MgCl2 (TaKaRa), 200 µM dNTP, 200 nM forward primer, 200 nM reverse primer, 12.5 µg ultrapure BSA (Ambion), and 1 unit Ex Taq HotStart polymerase (TaKaRa). Cycling conditions were 94ºC for 2 min, followed by 25 cycles of 94ºC for 30 sec, 55ºC for 30 sec, 72ºC for 1 min, with a final extension of 72ºC for 10 min. All samples were amplified in quadruplicates, which were combined before purification. Primer 799f and 1193r amplify a mitochondrial product of about 800 bp and a bacterial product of about 500 bp. We isolated the bacterial product by separating the PCR products on a 3% low melt agarose gel (2% agarose for root samples) and excising a band of agarose with size 400 bp to 700 bp. DNA was extracted from the gel using the QIAquick gel extraction kit (Qiagen). After purification, DNA was quantified using the PicoGreen assay (Invitrogen) and the quality was checked using a Bioanalyzer (Agilent). DNA concentration was adjusted to 1 ng/µl. The amplicon libraries were prepared by pooling 10 ng of each PCR.SRS387974AMPLICONMETAGENOMICPCR00Technical ReadAdapter11Application ReadForward5454 GS FLXmothurv 1.29.1SRA064179ArabidoSRP018030PRJNA73097Phyllosphere and Rhizosphere 16S Community AnalysisThe purpose of this study is to describe the bacterial community associated with Arabidopsis thaliana leaves and roots.
<p>Bacterial communities associated with the phyllosphere and rhizosphere of Arabidopsis thaliana were analyzed by PCR amplification of the 16S rDNA gene and 454 sequencing. Arabidopsis roots and leaves were harvested at 4 different sites. DNA was extracted from the roots and the leaves and amplified with 16S primers.uncultured bacteriumbioproject73097trueSRS387974SAMN01888401MIMARKS Survey related sample from leaf_epiphytes77133uncultured bacteriumbiosample1888401bioprojectPRJNA73097lat_lon41.354836, -86.737353biometemperate grasslandcollection_date15-Apr-2008featuredisturbed fieldinvestigation_typemiens-surveyproject_nameBacterial communities associated with the leaves and the roots of Arabidopsis thaliana geo_loc_nameUSA: Route Marker 166, Indianamaterialairenv_packageMIGS/MIMS/MIMARKS.plant-associatedspecific_hostArabidopsis thalianaSRR671965run8SRX220432experiment11run6leaves_NL_epiphyteSRP018030Primer 799F (5'-AACMGGATTAGATACCCKG-3'), which minimizes contamination from plastid DNA (Chelius and Triplett, 2001) and a primer designed for this study, 1193r (5'-ACGTCATCCCCACCTTCC-3'), were used to amplify V5, V6 and V7 of the 16S rRNA gene. The forward primer was fused to the 454 Life Sciences primer B and the reverse primer was fused to the adapter A and a barcode in order to sequence the hypervariable regions V6 and V7. Each 25 µl PCR reaction contained 10 ng (for the endophytic fraction) or 1 ng (for the epiphytic fraction) of DNA, Mg2+ free PCR buffer (TaKaRa), 3mM MgCl2 (TaKaRa), 200 µM dNTP, 200 nM forward primer, 200 nM reverse primer, 12.5 µg ultrapure BSA (Ambion), and 1 unit Ex Taq HotStart polymerase (TaKaRa). Cycling conditions were 94ºC for 2 min, followed by 25 cycles of 94ºC for 30 sec, 55ºC for 30 sec, 72ºC for 1 min, with a final extension of 72ºC for 10 min. All samples were amplified in quadruplicates, which were combined before purification. Primer 799f and 1193r amplify a mitochondrial product of about 800 bp and a bacterial product of about 500 bp. We isolated the bacterial product by separating the PCR products on a 3% low melt agarose gel (2% agarose for root samples) and excising a band of agarose with size 400 bp to 700 bp. DNA was extracted from the gel using the QIAquick gel extraction kit (Qiagen). After purification, DNA was quantified using the PicoGreen assay (Invitrogen) and the quality was checked using a Bioanalyzer (Agilent). DNA concentration was adjusted to 1 ng/µl. The amplicon libraries were prepared by pooling 10 ng of each PCR.SRS387970AMPLICONMETAGENOMICPCR00Technical ReadAdapter11Application ReadForward5454 GS FLXmothurv 1.29.1SRA064179ArabidoSRP018030PRJNA73097Phyllosphere and Rhizosphere 16S Community AnalysisThe purpose of this study is to describe the bacterial community associated with Arabidopsis thaliana leaves and roots.
<p>Bacterial communities associated with the phyllosphere and rhizosphere of Arabidopsis thaliana were analyzed by PCR amplification of the 16S rDNA gene and 454 sequencing. Arabidopsis roots and leaves were harvested at 4 different sites. DNA was extracted from the roots and the leaves and amplified with 16S primers.uncultured bacteriumbioproject73097trueSRS387970SAMN01888397MIMARKS Survey related sample from leaf_epiphytes77133uncultured bacteriumbiosample1888397bioprojectPRJNA73097lat_lon41.540244, -86.425794biometemperate grasslandcollection_date30-Apr-2008featuredisturbed fieldinvestigation_typemiens-surveyproject_nameBacterial communities associated with the leaves and the roots of Arabidopsis thaliana geo_loc_nameUSA: North Liberty, Indianamaterialairenv_packageMIGS/MIMS/MIMARKS.plant-associatedspecific_hostArabidopsis thalianaSRR671963run6SRX220261experiment6run4leaves_ME_epiphyteSRP018030Primer 799F (5'-AACMGGATTAGATACCCKG-3'), which minimizes contamination from plastid DNA (Chelius and Triplett, 2001) and a primer designed for this study, 1193r (5'-ACGTCATCCCCACCTTCC-3'), were used to amplify V5, V6 and V7 of the 16S rRNA gene. The forward primer was fused to the 454 Life Sciences primer B and the reverse primer was fused to the adapter A and a barcode in order to sequence the hypervariable regions V6 and V7. Each 25 µl PCR reaction contained 10 ng (for the endophytic fraction) or 1 ng (for the epiphytic fraction) of DNA, Mg2+ free PCR buffer (TaKaRa), 3mM MgCl2 (TaKaRa), 200 µM dNTP, 200 nM forward primer, 200 nM reverse primer, 12.5 µg ultrapure BSA (Ambion), and 1 unit Ex Taq HotStart polymerase (TaKaRa). Cycling conditions were 94ºC for 2 min, followed by 25 cycles of 94ºC for 30 sec, 55ºC for 30 sec, 72ºC for 1 min, with a final extension of 72ºC for 10 min. All samples were amplified in quadruplicates, which were combined before purification. Primer 799f and 1193r amplify a mitochondrial product of about 800 bp and a bacterial product of about 500 bp. We isolated the bacterial product by separating the PCR products on a 3% low melt agarose gel (2% agarose for root samples) and excising a band of agarose with size 400 bp to 700 bp. DNA was extracted from the gel using the QIAquick gel extraction kit (Qiagen). After purification, DNA was quantified using the PicoGreen assay (Invitrogen) and the quality was checked using a Bioanalyzer (Agilent). DNA concentration was adjusted to 1 ng/µl. The amplicon libraries were prepared by pooling 10 ng of each PCR.SRS387832AMPLICONMETAGENOMICPCR00Technical ReadAdapter11Application ReadForward5454 GS FLXmothurmothur v.1.29.1SRA064179ArabidoSRP018030PRJNA73097Phyllosphere and Rhizosphere 16S Community AnalysisThe purpose of this study is to describe the bacterial community associated with Arabidopsis thaliana leaves and roots.
<p>Bacterial communities associated with the phyllosphere and rhizosphere of Arabidopsis thaliana were analyzed by PCR amplification of the 16S rDNA gene and 454 sequencing. Arabidopsis roots and leaves were harvested at 4 different sites. DNA was extracted from the roots and the leaves and amplified with 16S primers.uncultured bacteriumbioproject73097trueSRS387832SAMN01888393MIMARKS Survey related sample from leaf_epiphytes77133uncultured bacteriumbiosample1888393bioprojectPRJNA73097lat_lon42.0927, -86.356322biometemperate grasslandcollection_date25-Apr-2008featuredisturbed fieldinvestigation_typemiens-surveyproject_nameBacterial communities associated with the leaves and the roots of Arabidopsis thaliana geo_loc_nameUSA: Michigan Extension, Michiganmaterialairenv_packageMIGS/MIMS/MIMARKS.plant-associatedspecific_hostArabidopsis thalianaSRR671961run4SRX219208experiment2run2leaves_LMC_epiphyteSRP018030Primer 799F (5'-AACMGGATTAGATACCCKG-3'), which minimizes contamination from plastid DNA (Chelius and Triplett, 2001) and a primer designed for this study, 1193r (5'-ACGTCATCCCCACCTTCC-3'), were used to amplify V5, V6 and V7 of the 16S rRNA gene. The forward primer was fused to the 454 Life Sciences primer B and the reverse primer was fused to the adapter A and a barcode in order to sequence the hypervariable regions V6 and V7. Each 25 µl PCR reaction contained 10 ng (for the endophytic fraction) or 1 ng (for the epiphytic fraction) of DNA, Mg2+ free PCR buffer (TaKaRa), 3mM MgCl2 (TaKaRa), 200 µM dNTP, 200 nM forward primer, 200 nM reverse primer, 12.5 µg ultrapure BSA (Ambion), and 1 unit Ex Taq HotStart polymerase (TaKaRa). Cycling conditions were 94ºC for 2 min, followed by 25 cycles of 94ºC for 30 sec, 55ºC for 30 sec, 72ºC for 1 min, with a final extension of 72ºC for 10 min. All samples were amplified in quadruplicates, which were combined before purification. Primer 799f and 1193r amplify a mitochondrial product of about 800 bp and a bacterial product of about 500 bp. We isolated the bacterial product by separating the PCR products on a 3% low melt agarose gel (2% agarose for root samples) and excising a band of agarose with size 400 bp to 700 bp. DNA was extracted from the gel using the QIAquick gel extraction kit (Qiagen). After purification, DNA was quantified using the PicoGreen assay (Invitrogen) and the quality was checked using a Bioanalyzer (Agilent). DNA concentration was adjusted to 1 ng/µl. The amplicon libraries were prepared by pooling 10 ng of each PCR.SRS387494AMPLICONGENOMICPCR00Technical ReadAdapter11Application ReadForward5454 GS FLXmothurv.1.29.1SRA064179ArabidoSRP018030PRJNA73097Phyllosphere and Rhizosphere 16S Community AnalysisThe purpose of this study is to describe the bacterial community associated with Arabidopsis thaliana leaves and roots.
<p>Bacterial communities associated with the phyllosphere and rhizosphere of Arabidopsis thaliana were analyzed by PCR amplification of the 16S rDNA gene and 454 sequencing. Arabidopsis roots and leaves were harvested at 4 different sites. DNA was extracted from the roots and the leaves and amplified with 16S primers.uncultured bacteriumbioproject73097trueSRS387494SAMN01888389MIMARKS Survey related sample from leaf_epiphytes77133uncultured bacteriumbiosample1888389bioprojectPRJNA73097lat_lon42.090114, -86.393408biometemperate grasslandcollection_date16-Apr-2008featuredisturbed fieldinvestigation_typemiens-surveyproject_nameBacterial communities associated with the leaves and the roots of Arabidopsis thaliana geo_loc_nameUSA: Lake Michigan College, Michiganmaterialairenv_packageMIGS/MIMS/MIMARKS.plant-associatedspecific_hostArabidopsis thalianaSRR671959run2Socompa Stromatolite 16S pyrotagsWhole DNA was extracted from 0.5 g of freeze-dried stromatolite was washed in 10 ml of 10% NaCl and incubated at 40°C for 15 min and then centrifuged at 8200 x g for 15 min (three times). The SN (approx. 15 ml) is maintained for the precipitation of the EPS (a), while the pellet is retained for the extraction of genomic DNA (b). Precipitation of EPS was done according to Hong Liu, et al, with some adaptation2: The supernatant is mixed with 100% ethanol and taken to a concentration of 70% ethanol and incubated O.N at 4°C. Centrifuged 15 min at 4000 x g at 20°C. The supernatant is discarded and the resulting pellet was solubilized in sterile H2O and dialyzed against H2Od in a 10.000 Da MWCO membrane for 3 hours (3 times) at 4°C. Half was lyophilized for dry weight determination, while the other half was used for chemical analysis and HPLC. Genomic DNA extraction was done according to Falcon et al1, whit modifications : The cell pellet of sediment was resuspended in lysis buffer (Tris-HCl, pH 8, 100 mM NaCl 1.5 M, EDTA, pH 8, 100 mM; Na3PO4, pH 8, 100 M; CTAB 1%). The cells were frozen and thawed first in N2 (l) and then in a water bath at 65°C (three times). The mixture was incubated with lysozyme (1 mg / ml) for 30 min at 37°C, then added Proteinase K (0.1 mg / ml), 3% final SDS and incubated ON at 60°C. Supernatant were collected after 10 min of centrifugation at 5000 x g. Organic extractions are made first with 1 Vol. of phenol:chloroform:isoamyl acohol (25:24:1) and then with 1 Vol. of chloroform: isoamyl alcohol (24:1). DNA (aqueous phase) is separated and precipitated with cold Isopropanol (0.7 Vol.) and Sodium Acetate 3M (0,1 Vol), incubated 2 hours at -20°C and then, the DNA precipitate is washed (three times) with cold 70% ethanol, collecting the DNA between each wash with centrifugation for 15 min 15000 x g at 4°C. Finally, the DNA is dried in sterile air and resuspended in DNAse-free H2O. The V4 hyper variable region of the 16s rRNA gene was amplified using the following universal primers containing the Roche 454 sequencing A and B adaptors (underlined) and a 10 nucleotide “multiple identifier” (MID) to sort samples (bold): 520F (5’- CGTATCGCCTCCCTCGCGCCATCAGAGCACTGTAGAYTGGGYDTAAAGNG-3’, CTATGCGCCTTGCCAGCCCGCTCAGTACCRGGGTHTCTAATCC, CTATGCGCCTTGCCAGCCCGCTCAGTACCAGAGTATCTAATTC, and CTATGCGCCTTGCCAGCCCGCTCAGCTACDSRGGTMTCTAATC, CTATGCGCCTTGCCAGCCCGCTCAGTACNVGGGTATCTAATCC) obtained from RDP’s Pyrosequencing Pipeline: http://pyro.cme.msu.edu/pyro/help. Five independent PCRs were performed. The PCR mix (final volume 25 ul) contained 2.5 ulFastStart High Fidelity 10X Reaction Buffer (Roche Applied Science, Mannheim, Germany), 20 ng of template DNA, 0.4 uM each primer, 1.25 U FastStart High Fidelity Enzyme Blend (Roche Applied Science), and 0.2 mM DNTPs. The PCR conditions were 95 °C for 5 minutes for initial denaturalization, followed by 95 °C for 45 seconds, 57 °C for 45 seconds, 72 °C for 60 seconds in 30 cycles, and a final elongation step at 72°C for 4 minutes. Two negative control reactions containing all components were performed without the template. The five reactions were pooled and purified using AMPure beads XP. Quantification of the purified PCR product was performed by using Quant- iTPicoGreendsDNA Kit (Invitrogen Molecular Probes Inc, Oregon, USA). Purified PCR product were immobilized onto DNA capture beads, amplified through emulsion-based clonal amplification (emPCR), and sequenced together in a PicoTiterPlate device on a Genome Sequencer FLX (Roche Applied Science) using Titanium Chemistry according to the manufacturer’s instructions at INDEAR (Argentina) Genome sequencing facility.Socompa StromatoliteAMPLICONMETAGENOMICPCR2000Application ReadForward1454 GS FLX TitaniumSTROMATOLITES AT SOCOMPA LAKE: MICROBIALCOMMUNITIES DEVELOPING UNDER ALKALINE, HIPERARSENIC AND HIPERSALYNE VOLCANIC ASSOCIATED ECOSYSTEM OVER 4000 M IN THE ARGENTINEAN PUNAThe High-Altitude Andean Lakes (HAAL) in the Argentinian Puna-High Andes region represent an almost unexplored ecosystem of shallow lakes at altitudes from 3,000 to 6,000 m. Although exposed to extreme conditions: i.e. volcanic settings, high UV irradiation, hypersalinity, drastic temperature changes, desiccation, and high pH, an outstanding microbial biodiversity has developed, most of them ordered in multi- layered flat mats and stubby pillars called microbialites. Calcareous cyanobacterial microbialites defined as stromatolites and thrombolites were common in ancient shallow marine environments. Today, they are restricted to a few lacustrine and perimarine settings. Compared to them, those from HAAL are the only ones that exist under such hostile environmental conditions. Moreover, they experience environmental conditions resembling those that prevailed at the early Earth, making their study even more promising as a modern template of Early Life development. The present dataset of bacterial diversity assessed by pyrosequencingV4 region of 16S rRNA gene correspond to the first observation of extreme microbialites harboring a diverse eu-endolythic microbiota at Laguna Socompa (4000 m asl, pH 9; salinity: 83 ppm; 35 mg L-1 As) at the bottom of Socompa Volcano Northwest Argentina.Socompa Stromatolite Bacterial DiversityDNA from Stromatolite was extracted. 16S rDNA was amplified using RDP designed primers and where sequenced using 454 titanium chemistry, obtaining 113,255 high quality-filtered sequences.SRS256213SAMN00704299Socompa 08-24-2010Socompa stromatolite homogenate 24-Aug-2010496921biosample704299ERX149297BACT16S_TSP_28_05ERP001381Airborne bacteria in MilanERS132565TSP_28_05BACT16S_TSP_28_05_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132565TSP_28_05655179air metagenomeTSP_28_05air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797502Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-05-28Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGATGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117253BACT16S_TSP_28_05_1_runERX149297BACT16S_TSP_28_05ERX149296BACT16S_TSP_27_05ERP001381Airborne bacteria in MilanERS132564TSP_27_05BACT16S_TSP_27_05_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132564TSP_27_05655179air metagenomeTSP_27_05air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797501Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-05-27Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGATGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117252BACT16S_TSP_27_05_1_runERX149296BACT16S_TSP_27_05ERX149295BACT16S_TSP_26_05ERP001381Airborne bacteria in MilanERS132563TSP_26_05BACT16S_TSP_26_05_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132563TSP_26_05655179air metagenomeTSP_26_05air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797500Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-05-26Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGATGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117251BACT16S_TSP_26_05_1_runERX149295BACT16S_TSP_26_05ERX149288BACT16S_TSP_30_11ERP001381Airborne bacteria in MilanERS132587TSP_30_11BACT16S_TSP_30_11_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132587TSP_30_11655179air metagenomeTSP_30_11air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797524Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-11-30Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCTGCTGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117275BACT16S_TSP_30_11_1_runERX149288BACT16S_TSP_30_11ERX149287BACT16S_TSP_04_12ERP001381Airborne bacteria in MilanERS132591TSP_04_12BACT16S_TSP_04_12_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132591TSP_04_12655179air metagenomeTSP_04_12air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797528Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-12-04Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCTGCTGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117279BACT16S_TSP_04_12_1_runERX149287BACT16S_TSP_04_12ERX149283BACT16S_TSP_28_02ERP001381Airborne bacteria in MilanERS132557TSP_28_02BACT16S_TSP_28_02_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132557TSP_28_02655179air metagenomeTSP_28_02air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797534Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-02-28Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGCAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117245BACT16S_TSP_28_02_1_runERX149283BACT16S_TSP_28_02ERX149281BACT16S_TSP_25_02ERP001381Airborne bacteria in MilanERS132554TSP_25_02BACT16S_TSP_25_02_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132554TSP_25_02655179air metagenomeTSP_25_02air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797531Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-02-25Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGCAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117242BACT16S_TSP_25_02_1_runERX149281BACT16S_TSP_25_02ERX149278BACT16S_TSP_29_11ERP001381Airborne bacteria in MilanERS132586TSP_29_11BACT16S_TSP_29_11_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132586TSP_29_11655179air metagenomeTSP_29_11air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797523Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-11-29Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCATGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117274BACT16S_TSP_29_11_1_runERX149278BACT16S_TSP_29_11ERX149276BACT16S_TSP_27_11ERP001381Airborne bacteria in MilanERS132584TSP_27_11BACT16S_TSP_27_11_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132584TSP_27_11655179air metagenomeTSP_27_11air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797521Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-11-27Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCATGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117272BACT16S_TSP_27_11_1_runERX149276BACT16S_TSP_27_11ERX149274BACT16S_TSP_25_11ERP001381Airborne bacteria in MilanERS132582TSP_25_11BACT16S_TSP_25_11_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132582TSP_25_11655179air metagenomeTSP_25_11air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797519Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-11-25Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCATGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117270BACT16S_TSP_25_11_1_runERX149274BACT16S_TSP_25_11ERX149273BACT16S_TSP_31_08ERP001381Airborne bacteria in MilanERS132579TSP_31_08BACT16S_TSP_31_08_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132579TSP_31_08655179air metagenomeTSP_31_08air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797516Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-08-31Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGCAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117267BACT16S_TSP_31_08_1_runERX149273BACT16S_TSP_31_08ERX149272BACT16S_TSP_30_08ERP001381Airborne bacteria in MilanERS132578TSP_30_08BACT16S_TSP_30_08_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132578TSP_30_08655179air metagenomeTSP_30_08air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797515Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-08-30Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGCAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117266BACT16S_TSP_30_08_1_runERX149272BACT16S_TSP_30_08ERX149271BACT16S_TSP_29_08ERP001381Airborne bacteria in MilanERS132577TSP_29_08BACT16S_TSP_29_08_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132577TSP_29_08655179air metagenomeTSP_29_08air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797514Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-08-29Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGCAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117265BACT16S_TSP_29_08_1_runERX149271BACT16S_TSP_29_08ERX149267BACT16S_TSP_27_08ERP001381Airborne bacteria in MilanERS132575TSP_27_08BACT16S_TSP_27_08_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132575TSP_27_08655179air metagenomeTSP_27_08air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797512Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-08-27Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117263BACT16S_TSP_27_08_1_runERX149267BACT16S_TSP_27_08ERX149266BACT16S_TSP_26_08ERP001381Airborne bacteria in MilanERS132574TSP_26_08BACT16S_TSP_26_08_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132574TSP_26_08655179air metagenomeTSP_26_08air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797511Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-08-26Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117262BACT16S_TSP_26_08_1_runERX149266BACT16S_TSP_26_08ERX149265BACT16S_TSP_25_08ERP001381Airborne bacteria in MilanERS132573TSP_25_08BACT16S_TSP_25_08_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132573TSP_25_08655179air metagenomeTSP_25_08air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797510Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-08-25Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117261BACT16S_TSP_25_08_1_runERX149265BACT16S_TSP_25_08ERX149264BACT16S_TSP_24_08ERP001381Airborne bacteria in MilanERS132572TSP_24_08BACT16S_TSP_24_08_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132572TSP_24_08655179air metagenomeTSP_24_08air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797509Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-08-24Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117260BACT16S_TSP_24_08_1_runERX149264BACT16S_TSP_24_08ERX149293BACT16S_TSP_27_02ERP001381Airborne bacteria in MilanERS132556TSP_27_02BACT16S_TSP_27_02_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132556TSP_27_02655179air metagenomeTSP_27_02air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797533Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-02-27Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGAGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117244BACT16S_TSP_27_02_1_runERX149293BACT16S_TSP_27_02ERX149292BACT16S_TSP_04_03ERP001381Airborne bacteria in MilanERS132561TSP_04_03BACT16S_TSP_04_03_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132561TSP_04_03655179air metagenomeTSP_04_03air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797498Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-03-04Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGAGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117249BACT16S_TSP_04_03_1_runERX149292BACT16S_TSP_04_03ERX149289BACT16S_TSP_01_03ERP001381Airborne bacteria in MilanERS132558TSP_01_03BACT16S_TSP_01_03_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132558TSP_01_03655179air metagenomeTSP_01_03air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797535Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-03-01Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGAGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117246BACT16S_TSP_01_03_1_runERX149289BACT16S_TSP_01_03ERX149286BACT16S_TSP_03_12ERP001381Airborne bacteria in MilanERS132590TSP_03_12BACT16S_TSP_03_12_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132590TSP_03_12655179air metagenomeTSP_03_12air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797527Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-12-03Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCTGCTGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117278BACT16S_TSP_03_12_1_runERX149286BACT16S_TSP_03_12ERX149285BACT16S_TSP_02_12ERP001381Airborne bacteria in MilanERS132589TSP_02_12BACT16S_TSP_02_12_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132589TSP_02_12655179air metagenomeTSP_02_12air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797526Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-12-02Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCTGCTGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117277BACT16S_TSP_02_12_1_runERX149285BACT16S_TSP_02_12ERX149284BACT16S_TSP_01_12ERP001381Airborne bacteria in MilanERS132588TSP_01_12BACT16S_TSP_01_12_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132588TSP_01_12655179air metagenomeTSP_01_12air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797525Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-12-01Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCTGCTGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117276BACT16S_TSP_01_12_1_runERX149284BACT16S_TSP_01_12ERX149282BACT16S_TSP_26_02ERP001381Airborne bacteria in MilanERS132555TSP_26_02BACT16S_TSP_26_02_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132555TSP_26_02655179air metagenomeTSP_26_02air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797532Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-02-26Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGCAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117243BACT16S_TSP_26_02_1_runERX149282BACT16S_TSP_26_02ERX149280BACT16S_TSP_24_02ERP001381Airborne bacteria in MilanERS132553TSP_24_02BACT16S_TSP_24_02_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132553TSP_24_02655179air metagenomeTSP_24_02air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797530Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-02-24Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGCAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117241BACT16S_TSP_24_02_1_runERX149280BACT16S_TSP_24_02ERX149279BACT16S_TSP_23_02ERP001381Airborne bacteria in MilanERS132552TSP_23_02BACT16S_TSP_23_02_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132552TSP_23_02655179air metagenomeTSP_23_02air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797529Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-02-23Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGCAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117240BACT16S_TSP_23_02_1_runERX149279BACT16S_TSP_23_02ERX149277BACT16S_TSP_28_11ERP001381Airborne bacteria in MilanERS132585TSP_28_11BACT16S_TSP_28_11_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132585TSP_28_11655179air metagenomeTSP_28_11air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797522Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-11-28Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCATGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117273BACT16S_TSP_28_11_1_runERX149277BACT16S_TSP_28_11ERX149275BACT16S_TSP_26_11ERP001381Airborne bacteria in MilanERS132583TSP_26_11BACT16S_TSP_26_11_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132583TSP_26_11655179air metagenomeTSP_26_11air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797520Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-11-26Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCATGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117271BACT16S_TSP_26_11_1_runERX149275BACT16S_TSP_26_11ERX149269BACT16S_TSP_01_09ERP001381Airborne bacteria in MilanERS132580TSP_01_09BACT16S_TSP_01_09_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132580TSP_01_09655179air metagenomeTSP_01_09air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797517Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-09-01Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGCAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117268BACT16S_TSP_01_09_1_runERX149269BACT16S_TSP_01_09ERX149268BACT16S_TSP_28_08ERP001381Airborne bacteria in MilanERS132576TSP_28_08BACT16S_TSP_28_08_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132576TSP_28_08655179air metagenomeTSP_28_08air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797513Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-08-28Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGAGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117264BACT16S_TSP_28_08_1_runERX149268BACT16S_TSP_28_08ERX149310BACT16S_TSP_31_05ERP001381Airborne bacteria in MilanERS132568TSP_31_05BACT16S_TSP_31_05_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132568TSP_31_05655179air metagenomeTSP_31_05air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797505Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-05-31Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersATGATGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117256BACT16S_TSP_31_05_1_runERX149310BACT16S_TSP_31_05ERX149309BACT16S_TSP_30_05ERP001381Airborne bacteria in MilanERS132567TSP_30_05BACT16S_TSP_30_05_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132567TSP_30_05655179air metagenomeTSP_30_05air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797504Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-05-30Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersATGATGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117255BACT16S_TSP_30_05_1_runERX149309BACT16S_TSP_30_05ERX149308BACT16S_TSP_03_06ERP001381Airborne bacteria in MilanERS132571TSP_03_06BACT16S_TSP_03_06_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132571TSP_03_06655179air metagenomeTSP_03_06air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797508Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-06-03Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersATGATGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117259BACT16S_TSP_03_06_1_runERX149308BACT16S_TSP_03_06ERX149307BACT16S_TSP_02_06ERP001381Airborne bacteria in MilanERS132570TSP_02_06BACT16S_TSP_02_06_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132570TSP_02_06655179air metagenomeTSP_02_06air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797507Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-06-02Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersATGATGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117258BACT16S_TSP_02_06_1_runERX149307BACT16S_TSP_02_06ERX149306BACT16S_TSP_01_06ERP001381Airborne bacteria in MilanERS132569TSP_01_06BACT16S_TSP_01_06_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132569TSP_01_06655179air metagenomeTSP_01_06air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797506Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-06-01Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersATGATGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117257BACT16S_TSP_01_06_1_runERX149306BACT16S_TSP_01_06ERX149298BACT16S_TSP_29_05ERP001381Airborne bacteria in MilanERS132566TSP_29_05BACT16S_TSP_29_05_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132566TSP_29_05655179air metagenomeTSP_29_05air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797503Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-05-29Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGATGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117254BACT16S_TSP_29_05_1_runERX149298BACT16S_TSP_29_05ERX149294BACT16S_TSP_25_05ERP001381Airborne bacteria in MilanERS132562TSP_25_05BACT16S_TSP_25_05_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132562TSP_25_05655179air metagenomeTSP_25_05air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797499Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-05-25Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGATGCpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117250BACT16S_TSP_25_05_1_runERX149294BACT16S_TSP_25_05ERX149291BACT16S_TSP_03_03ERP001381Airborne bacteria in MilanERS132560TSP_03_03BACT16S_TSP_03_03_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132560TSP_03_03655179air metagenomeTSP_03_03air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797537Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date03/03/201004/03/2010Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGAGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117248BACT16S_TSP_03_03_1_runERX149291BACT16S_TSP_03_03ERX149290BACT16S_TSP_02_03ERP001381Airborne bacteria in MilanERS132559TSP_02_03BACT16S_TSP_02_03_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132559TSP_02_03655179air metagenomeTSP_02_03air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797536Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-03-02Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersAGAGAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117247BACT16S_TSP_02_03_1_runERX149290BACT16S_TSP_02_03ERX149270BACT16S_TSP_02_09ERP001381Airborne bacteria in MilanERS132581TSP_02_09BACT16S_TSP_02_09_libAMPLICONMETAGENOMICPCR1520Application ReadForward11Application ReadReverse77Illumina Genome Analyzer IIxERA122915Andrea FranzettiERP001381Airborne bacteria in MilanTemporal variability of airborne bacterial communities and relations with the environmental factors in milan urban areaBacteria represent a relevant fraction of atmospheric suspended
particles. It is known that airborne bacteria can significantly affect human health
and ecosystems. However, the abundance and diversity of airborne microorganisms and
the factors influencing their diversity remain poorly investigated. In the present
work we used quantitative polymerase chain reaction (PCR) and Illumina technology to
provide a thorough description of airborne microbial communities of the Milan urban
area (Northern Italy). We collected 40 air samples, ten per season. Total bacterial
abundance was about 104 ribosomal operons m-3 of sampled air. Communities were
dominated by Actinobacteridae, Clostridiales, Sphingobacteriales and a few
proteobacterial orders (Burkholderiales, Rhizobiales, Sphingomonadales,
Pseudomonadales). A significant abundance of Chloroplasts was detected, especially
in warmer seasons, due to the presence of plant debris and pollens in the
particulate matter. A seasonal variability in the composition of microbial
communities was found, mainly due to a higher abundance of Actinobacteridae and
lower abundance of Chloroplasts in samples collected on cold days. At the same time,
intra-season variation in community composition was comparable to inter-season
variation. Soil and plants were the sources which most affected airborne bacterial
communities. This study demonstrated the potential of the Illumina technology and
quantitative real-time PCR to investigate the microbiological component of the
atmosphere, an environment largely neglected by previous studies.Airborne bacteria in Milanhttp://dx.doi.org/10.1007/s00253-012-4450-0ERS132581TSP_02_09655179air metagenomeTSP_02_09air metagenomeTotal suspended particulate matter (TSP) sampled on quartz fibre filters with a
high-volume sampler (ECHO HiVol, TCR TECORA, Milan, Italy) with a flux speed of 250 L
per minute for 24 hours. The sampler was placed at approximately 20 m from the nearest
roads and 50 m from the nearest traffic lights. TSP sampling was performed at
approximately 1.5 m from the ground.biosample1797518Investigation typeMIxSProject nameAirborne bacteria in MilanENA-CHECKLISTGSC:MIxS v2.1ENA-KEYWORDGSC, MIxS, MIMARKSTarget gene16S rRNASequencing methodPyrosequencingEnviornmental packageairGeographic location (latitude)45.52222Geographic location (longitude)9.2125Geographic location (country:region,area)ItalyCollection date2010-09-02Environment (biome)terrestrial biome ENVO:00000446Environment (featurel)aerial habitat ENVO:00000568Environment (material)aerosol ENVO:00010505DepthmElevation122 Amount or size of sample collected360000 litres of airgmultiplex identifiersCAGCAGpcr primers783F:CAGGATTAGATACCC , 1064R:CGACRRCCATGCANCACCTERR117269BACT16S_TSP_02_09_1_runERX149270BACT16S_TSP_02_09SRX196098Exp 2010exp2010Dispersal barrier of bacteria between the freshwater and marine biomesSRP0164963 lakes were sampled due to their difference in their proximity to sea coast. Air bacteria were resuspended in sterile lake water using vacuum cleaner with a water tank (AquaStream DS 5600, 1400W, Kärcher, Winnenden, Germany). Air and water samples from lakes were filtered onto 0.2-µm 47 mm Supor-200 filters (Pall Corp.) and stored at -80°C until processing. The same procedure was done with approximately 1g of the top 2cm of lake sediment. DNA was extracted using the Easy-DNA kit (Invitrogen, Carlsbad, CA, USA). Bacterial 16S rRNA genes were PCR amplified using forward primer 341 (5'-CCTACGGGNGGCWGCAG-3') and individually bar-coded reverse primers 805 (5'-GACTACHVGGGTATCTAATCC-3'). The total PCR products were divided into 2 pooled samples where in each, equal amounts of 86 amplicons with different sample-specific barcode sequences were mixed in order to get equal number of reads per sample. Pooled samples were sequenced using Roche/454 GS FLX Titanium technology. The resulting reads carried the sample-specific molecular barcodes and barcodes resemble samples as given: pooled sample #1: Sample ID: 100ML1a, tag_sequence: TATCGCA; Sample ID: 100ML1b, tag_sequence: TACTAGC; Sample ID:100ML1c, tag_sequence:TACTCTC; Sample ID: 100MabL1a, tag_sequence: TACTCGA; Sample ID: 100MabL1b, tag_sequence: TACTGAC; Sample ID:100MabL1c, tag_sequence: TACTGCA; Sample ID: 100MsedL1a, tag_sequence:TACGTCA; Sample ID: 100MsedL1b, tag_sequence: TACGAGT; Sample ID: 100MsedL1c, tag_sequence: TACGCTA; Sample ID: 75ML1a, tag_sequence: TAGTCAC; Sample ID: 75ML1b, tag_sequence: TAGACTC; Sample ID:75ML1c, tag_sequence: TAGACGA; Sample ID: 75MabL1a, tag_sequence: TAGAGAC; Sample ID:75MabL1b, tag_sequence: TAGAGCA; Sample ID: 75MabL1c, tag_sequence: TAGCTCA; Sample ID: 75MsedL1a, tag_sequence: TAGCACT; Sample ID: 75MsedL1b, tag_sequence: TAGCAGA; Sample ID: 75MsedL1c, tag_sequence: TAGCGTA; Sample ID: 50ML1a, tag_sequence: TCTACTC; Sample ID: 50ML1b, tag_sequence: TCTCTCA; Sample ID: 50ML1c, tag_sequence:TCTCATC; Sample ID:50MabL1a, tag_sequence:TCTCACT; Sample ID: 50MabL1b, tag_sequence: TCTCAGA; Sample ID: 50MabL1c, tag_sequence: TCTGAGT; Sample ID: 50MsedL1a, tag_sequence: TCATAGC; Sample ID:50MsedL1b, tag_sequence:TCATCTC; Sample ID:50MsedL1c, tag_sequence:TCATCGA; Sample ID:25ML1a, tag_sequence: TCATGAC; Sample ID: 25ML1b, tag_sequence:TCATGCA; Sample ID:25ML1c,tag_sequence:TCACTAC; Sample ID:25MabL1a, tag_sequence: TCACTCT; Sample ID:25MabL1b, stag_sequence:TCACTGA; Sample ID:25MabL1c, tag_sequence:TCACACA; Sample ID: 25MsedL1a, tag_sequence:TCACAGT; Sample ID:25MsedL1b, tag_sequence:TCACGTA; Sample ID:25MsedL1c, tag_sequence:TCACGAT; Sample ID: 0ML1a, tag_sequence: TCAGTCA; Sample ID: 0ML1b, tag_sequence: TCAGATC; Sample ID:0ML1c, tag_sequence:TCAGAGA; Sample ID: 0MabL1a, tag_sequence:TCAGCTA; Sample ID:0MabL1b, tag_sequence:TCGTAGA; Sample ID:0MabL1c, tag_sequence:TCGTGTA; sample ID:0MsedL1a, tag_sequence:TCGATCA; Sample ID: 0MsedL1b, tag_sequence:TCGACTA; Sample ID: 0MsedL1c, tag_sequence:TCGCATA; Sample ID: controlL1a, tag_sequence:TGTACGA; Sample ID: controlL1b, tag_sequence:TGTAGCA; Sample ID:controlL1c, tag_sequence:TGTCACA; Sample ID: 100ML2a, tag_sequence: TGTCGTA; Sampel ID: 100ML2b, tag_sequence:TGTGTCA; Sample ID:100ML2c, tag_sequence: TGTGCTA; Sample ID: 100MabL2a, tag_sequence:TGATCAC; Sample ID: 100MabL2b, tag_sequence:TGACTCA; Sample ID:100MabL2c, tag_sequence: TGACACT; sample ID:100MsedL2a, tag_sequence: TGAGTAC; Sample ID: 100MsedL2b, tag_sequence: TGAGTCT; Sample ID: 100MsedL2c, tag_sequence: TGAGTGA; Sample ID: 75ML2a, tag_sequence: TGAGCAT; Sample ID: 75ML2b, tag_sequence: TGCTAGA; Sample ID: 75ML2c, tag_sequence:TGCTGTA; Sample ID: 75MabL2a, tag_sequence: TGCATCA; Sample ID: 75MabL2b, tag_sequence: TGCACTA; Sample ID: 75MabL2c, tag_sequence: TGCGATA; Sample ID: 75MsedL2a, tag_sequence: ATACTGC; Sample ID: 75MsedL2b, tag_sequence: ATACGCT; Sample ID: 75MsedL2c, tag_sequence: ATAGCGT; Sample ID: 50ML2a, tag_sequence: ATCTCAC; Sample ID: 50ML2b, tag_sequence: ATCATGC; Sample ID: 50ML2c, tag_sequence: ATCACTC; Sample ID: 50MabL2a, tag_sequence: ATCACGT; Sample ID: 50MabL2b, tag_sequence: ATCAGAC; Sample ID: 50MabL2c, tag_sequence: ATCAGCT; Sample ID: 50MsedL2a, tag_sequence: ATCGTGT; Sample ID: 50MsedL2b, tag_sequence: ATCGACT; Sample ID: 50MsedL2c, tag_sequence: ATCGCAT; Sample ID: 25ML2a, tag_sequence: ATGTCGT; Sample ID:25ML2b, tag_sequence: ATGTGCT; Sample ID: 25ML2c, tag_sequence: ATGAGTC; Sample ID: T0 Sed L1, tag_sequence: ATGAGCA; Sample ID: T0 Sed L2, tag_sequence: ATGCTGT; Sample ID: T0 Sed L3, tag_sequence: ATGCACT; Sample ID: T0 M, tag_sequence: ATGCGAT; Sample ID: T0 L1, tag_sequence: ACTATGC; Sample ID: T0 L2, tag_sequence: ACTACAC; Sample ID:T0 L3, tag_sequence: ACTACGT; Sample ID: T0 B, tag_sequence: ACTAGTC pooled sample #2: Sample ID: 25MabL2a, tag_sequence: TATCGCA; Sample ID: 25MabL2b, tag_sequence: TACTAGC; Sample ID: 25MabL2c, tag_sequence: TACTCTC; Sample ID: 25MsedL2a, tag_sequence: TACTCGA; Sample ID: 25MsedL2b, tag_sequence: TACTGAC; Sample ID: 25MsedL2c, tag_sequence: TACTGCA; Sample ID: 0ML2a, tag_sequence: TACGTCA; Sample ID: 0ML2b, tag_sequence: TACGAGT; Sample ID: 0ML2c, tag_sequence: TACGCTA; Sample ID: 0MabL2a, tag_sequence: TAGTCAC; Sample ID: 0MabL2b, tag_sequence: TAGACTC; Sample ID: 0MabL2c, tag_sequence: TAGACGA; Sample ID: 0MsedL2a, tag_sequence: TAGAGAC; Sample ID: 0MsedL2b, tag_sequence: TAGAGCA; Sample ID: 0MsedL2c, tag_sequence: TAGCTCA; Sample ID: controlL2a, tag_sequence: TAGCACT; Sample ID: controlL2b, tag_sequence: TAGCAGA, Sample ID: controlL2c, tag_sequence: TAGCGTA; Sample ID: 100ML3a, tag_sequence: TCTACTC; Sample ID: 100ML3b, tag_sequence: TCTCTCA; Sample ID: 100ML3c, tag_sequence: TCTCATC; Sample ID: 100MabL3a, tag_sequence: TCTCACT; Sample ID: 100MabL3b, tag_sequence: TCTCAGA; Sample ID: 100MabL3c, tag_sequence: TCTGAGT; Sample ID: 100MsedL3a, tag_sequence: TCATAGC; Sample ID: 100MsedL3b, tag_sequence: TCATCTC; Sample ID: 100MsedL3c, tag_sequence: TCATCGA; Sample ID: 75ML3a, tag_sequence: TCATGAC; Sample ID: 75ML3b, tag_sequence: TCATGCA; Sample ID: 75ML3c, tag_sequence: TCACTAC; Sample ID: 75MabL3a, tag_sequence: TCACTCT; Sample ID: 75MabL3b, tag_sequence: TCACTGA; Sample ID: 75MabL3c, tag_sequence: TCACACA; Sample ID:75MsedL3a, tag_sequence: TCACAGT; Sample ID: 75MsedL3b, tag_sequence: TCACGTA; Sample ID: 75MsedL3c, tag_sequence: TCACGAT; Sample ID: 50ML3a, tag_sequence: TCAGTCA; Sample ID: 50ML3b, tag_sequence: TCAGATC; Sample ID: 50ML3c, tag_sequence: TCAGAGA; Sample ID: 50MabL3a, tag_sequence: TCAGCTA; Sample ID: 50MabL3b, tag_sequence: TCGTAGA; Sample ID: 50MabL3c, tag_sequence: TCGTGTA, Sample ID: 50MsedL3a, tag_sequence: TCGATCA; Sample ID: 50MsedL3b, tag_sequence: TCGACTA; Sample ID: 50MsedL3c, tag_sequence: TCGCATA; Sample ID: 25ML3a, tag_sequence: TGTACGA; Sample ID: 25ML3b, tag_sequence: TGTAGCA; Sample ID: 25ML3c, tag_sequence: TGTCACA; Sample ID: 25MabL3a, tag_sequence: TGTCGTA; Sample ID: 25MabL3b, tag_sequence: TGTGTCA; Sample ID: 25MabL3c, tag_sequence: TGTGCTA; Sample ID: 25MsedL3a, tag_sequence: TGATCAC; Sample ID: 25MsedL3b, tag_sequence: TGACTCA; Sample ID: 25MsedL3c, tag_sequence: TGACACT; Sample ID: 0ML3a, tag_sequence: TGAGTAC; Sample ID: 0ML3b, tag_sequence: TGAGTCT; Sample ID: 0ML3c, tag_sequence: TGAGTGA; Sample ID: 0MabL3a, tag_sequence: TGAGCAT; Sample ID: 0MabL3b, tag_sequence: TGCTAGA; Sample ID: 0MabL3c, tag_sequence: TGCTGTA; Sample ID: 0MsedL3a, tag_sequence: TGCATCA; Sample ID: 0MsedL3b, tag_sequence: TGCACTA; Sample ID: 0MsedL3c, tag_sequence: TGCGATA; Sample ID: controlL3a, tag_sequence: ATACTGC; Sample ID: controlL3b, tag_sequence: ATACGCT; Sample ID: controlL3c, tag_sequence: ATAGCGT; Sample ID: M.M, tag_sequence: ATCTCAC; Sample ID: M.M, tag_sequence: ATCATGC; Sample ID: M.M, tag_sequence: ATCACTC; Sample ID: control M, tag_sequence: ATCACGT; Sample ID: control M, tag_sequence: ATCAGAC; Sample ID: control M, tag_sequence: ATCAGCT; Sample ID: B.B, tag_sequence: ATCGTGT; Sample ID: B.B, tag_sequence: ATCGACT; Sample ID: B.B, tag_sequence: ATCGCAT; Sample ID: control B, tag_sequence: ATGTCGT; Sample ID: control B, tag_sequence: ATGTGCT; Sample ID: control B, tag_sequence: ATGAGTC; Sample ID: T0 Sed L1, tag_sequence: ATGAGCA; Sample ID: T0 Sed L2, tag_sequence: ATGCTGT; Sample ID: T0 Sed L3, tag_sequence: ATGCACT; Sample ID: T0 M, tag_sequence: ATGCGAT; Sample ID: T0 L1, tag_sequence: ACTATGC; Sample ID: T0 L2, tag_sequence: ACTACAC; Sample ID: T0 L3, tag_sequence: ACTACGT; Sample ID: T0 B, tag_sequence: ACTAGTCSRS371332SAMN01766609AMPLICONGENOMICPCR00Technical ReadAdapter11Application ReadForward5454 GS FLXSRA059612exp2010SRP016496PRJNA177753Freshwater communities response to marine conditions Targeted Locus (Loci)Batch cultures of natural bacterial communities (sediment, lake and air) were built along a gradient in marine conditions. 3 regions in Sweden were sampled to collect original communities that differ to their proximity to sea coast. The ultimate objective is to determine whether marine taxa can be retrieved from freshwater communities. In particular, we aimed at investigating which source contributes the most to marine taxa recruitment.aquatic metagenomebioproject177753trueSRS371332SAMN01766609General Sample for uncultured bacterium1169740aquatic metagenomebiosample1766609bioprojectPRJNA177753isolatebacteriaSRR594956Exp 2010